Cetartiodactyl GH genes - intron sequence alignment

Alignment of cetartiodactyl GH gene intron sequences with most indels removed (used for phylogenetic analysis).

(- indicates a gap).


Intron 1

                             20                  40                  60
Sheep      GTAAGCTCACGAAAATCCCCTCCA-TTAGCGTGTCCTAAGGGGGTGGCGGGGGGCCCTGC
Ox         GTAAGCTCGCTAAAATCCCCTCCA-TTCGCGTGTCCTAAAGGGGTAGCGGGGGGCCCTGC
RedDeer    GTAAGCTCACTAAAATCCCCTCCA-TTAGAATGTCCTAAAGGGGTGGCGGGGGGCCCCGC
Giraffe    GTAAGCTCGCTAAAATCCCCTCCACTTAACGTGTCCTAAAGGGGTGGTGGGGGGCC-TGC
Chevrotain GTAAGCCCCCTAAAATTCCTCCAGTTAGCCATGTCCTGAAGGGTGG-CGCAGAGCCCCTC
Dolphin    GTAAGCACCCTAAAATCCCCTCGGCTCGGTGTGTACTGAAGGGTGATGGGAGGGCCCTGC
Whale      GTAAGCACCCTAAAATCCCCTCGGCTTGGTGTGTACTGAAGGGTGATGGGAGGGCCCTGC
Hippo      GTAAGCCCCCTAAAATTCCCTCGGCTTGGTGTGTACTGAAGGGTGATGTGGGGGCCCCGA
Camel      GTAAGTGCCCTAAAATCCCCTTAGCTTGATGTGTACGGAAGGGTGATGTGGGGGCCCTGC
Pig        GCAAGTGCCCTAAAATCCCAGTGGCTTGGTGTGTTCTGAAGGGTGACGTGGGGGCCATGC

                             80                 100                 120
Sheep      CGATGGATGTGTCACAGCTTTGGGTTTTAGGGCTTCTGAATGTGAACATAGGTATCTGCA
Ox         CGATGGATGTGTCAGAGCTTTGGGCTTTAGGGCTTCCGAATGTGAACATAGGTATCTACA
RedDeer    CGATGGATGTGTCACAGCTTTGGGTTTTAGGGCTTCCGAATGTGAACATAGGTATCTACC
Giraffe    TGATGGATGGGGCACAGCTCTGGGTTTTAGGGCTTCTGAATGTGAACATAGGTATCTACA
Chevrotain CGATGTACAAGGCCCAATCTTGGGTTTTAGGGCTTCTGAATGCGAACCTCGCTGTCTACA
Dolphin    AGAGGGACGGGGCACAACCTCGGGCTTTGGGGCTTCTGGATGTGAGCACAGATATCTACC
Whale      AGATATATGGGGCACAACCTCGGGCGTTGGGGCTTCTGGATGTGAGCACGGATATCTACC
Hippo      AGACAGATGGGGCACAACCTTGGGCTTTGGGGCTTCTGAATGTGAGCATAGACATCTAGG
Camel      AGATGGATGGGGCACAACCTTGGTCTTTGGGGCTTCTGAATGTGAGCGTGGATATCTATG
Pig        AGATGGATGGGGCACAACCTTGGGCTTTGGGGTTTCCGAATGTGAGCATGGATATCTACT

                            140                 160                 180
Sheep      CCC-GACATTTGGCCAAGTTTGAAATGTTCTCAGTCCCTGGAGGGAAGGGCAGGCGGGG-
Ox         CCCAGACATTTGGCCAAGTTTGAAATGTTCTCAGTCCCTGGAGGGAAGGGTAGGTGGGGG
RedDeer    CCCAGGCATTTGGCCAAGTTTTAAAGGTTCTCAGTCCCTGGAGGGAAGGGCAGGCGGGGG
Giraffe    CTCAGACGTTTGGCCAAGTTTTAAATGTTCTCAGTCCCTGGAGGGAAGGGCAGGTGGGGG
Chevrotain CCCAGACATTTGGCCACGTCTTGAATGTTCTCAGTCCCTGAAGGATGGGGCAGCAGGAGG
Dolphin    CCCAGACACGTGACCAGGTTTGAAATGTTCTCATTCCCCGGGGGGAGGGGCGGTGGAGGG
Whale      CTCGGACACGTGATCAGGTTTTAAATGTTCTCATTCCCCGAGGCGAGGGGCGGTAGAGGG
Hippo      CCCAGACGTTTGACCAAGTTTTAAATGTTCTCATTCCCCGGGGGGAGAGGCAGGAGAGGG
Camel      CCCACACATTTGGCTACATTTTAGAAAGGAAGGGCCCCTGGAGCA-----CA-GAGAGGG
Pig        CCTAGATATGAGGCCAAGTTTTAAATGTCCCTGGGGGAGGGGGAG-GAGAAGGGACAGGG

                            200                 220                 240
Sheep      CTGGCAGGAATCAGGCGTCTAGCTCTCTGGGCCCCTCCGTCGCGGCCCTCCTGGTCTCTC
Ox         CTGGCAGGAATCAGGCGTCTAGCTCCCTGGGGCCCTCCGTCGCGGCCCTCCTGGTCTCTC
RedDeer    CTGGCAGGAATCAGGCGTCTAGCTCCCTGGGCCCCTCGGTCGCGGCCCTCCTGGTCTCTC
Giraffe    CTGGCAAGAATCAGGTGTCTAGCTCCCTGGGCCCCTCTGTCACGGCCCTCCTGGTCTCTC
Chevrotain GTGGCAGGAATCTGGTCTCTTGCTCTCCAGGCCCCTCTGTCACTGCCCTCCTGGTCTCTC
Dolphin    CTGGCAGGGACCAGGCCTCTTGCTCTCTGGACCCCTCCCTCTCGGCCCTCCTTGTCTCTC
Whale      CTGGCAGAGACCAGGCCTCTTGCTCTCTGGACCCCTCCCTCTCGGCCCTCCTTGTCTCTC
Hippo      CTGGCAGAGACCAGGCCTCTTGCTCTCTGGGCCCC---------GCCCTCCTTGTCTCTC
Camel      CTGGCAGAGACGAGGCCTCTGGCTCTCCAGGCCCCTTCCTCGCGGCCCTCCGGTTCTCTC
Pig        CTGGT-GAG-CCAGGCCTCTTG-TCTCTGGGTCCCTCTCTCACGGCCCTCCTGG----TC

             245
Sheep      CCTAG
Ox         CCTAG
RedDeer    CCTAG
Giraffe    CCTAG
Chevrotain CCTAG
Dolphin    TCTAG
Whale      TCTAG
Hippo      TCTAG
Camel      TCTAG
Pig        TCTAG
Intron 2
                             20                  40                  60
Sheep      GTAAGCTCCCCAGAGATGTGTCCTAGAGGTGGGAGGCAGGAAGGGGTGAATCCGCCCCCC
Ox         GTAAGCTCCCGAGGGATGCGTCCTAGGGGTGGGAGGCAGGAAGGGGTGAATCCACCCCCC
RedDeer    GTAAGCTCCCCAGGGATGCGTCCTAGGGGTGGGAGGCAGGAAGGGGTGAATCTGCCCCCC
Giraffe    GTAAGCTCCCCAGGGATGCATCCTAGGGGTGGGAGGCAGGAAGGGGTGAATCCGCCCCCC
Chevrotain GTAAGCTCCCCTGGGGTGCCTACGCGTGGCGGGTGGCAGGAAGGGATGAATCCGTCCCGC
Dolphin    GTAAGCTCCCCAGGGACGCGTACTAGTGGCGGGTGGCAGGAAGGGCTGAATCCGTCCCCC
Whale      GTAAGCTCCTCAGGGATGCGTACTAGTGGCGGGTGGCAGGAAGGGGTGAATCCGTCCCCC
Hippo      GTAAGCTCCTCAGGGATGTGTTCTAGTGGCGGGTGGCAGGAAGGGGTGAATCCGCCCCCC
Camel      GTAAGCTCCTCAGGGATGGGTGCTAGTGGGGGGTGGCAGGAAGGGGTGAACCCACCCCCC
Pig        GTAAGCTCCCCAGGGA-GGGTGCTGGAGGGGGGTGGTGGAGAGGGGTGAATTCGTCCCTC

                             80                 100                 120
Sheep      TCCACACAATGGGAGGGAACTGAGGACCTCAGTGGTATTTTATCCAAGTAAGGATGTGGT
Ox         TCCACACAGTGGGAGGAAACTGAGGAGTTCAGCCGTATTTTATCCAAGTAGGGATGTGGT
RedDeer    TCCACAGAGTGGG-GGTCACTGAGGAGTTCAGGGGAATTTTATCCAAGTGAGGATGCGGT
Giraffe    TCCACATAGTGGGAGGAAACTGAGGAGCTCAGAGGTATTTTATCCAAATGAGGATGCGGT
Chevrotain TTCATGTAGTGGGAAGAAACTGAGGTGTTCAAGGGTATTTTATCCAAGTGAGGCTGCCGT
Dolphin    TCCACGCAGTGGGAGGAAACTAAGGAGTTCAGAGGTATTTTATCCGAGTGAAGATGCTGT
Whale      TCCACGTAGTGGGAGGAAACTAAGGCGTTCAGAGGTATTTTATCCGAGTGAAGATGCTGT
Hippo      TCTGCGTAGTGGGAGAAAACTAAGGAGTTCAGGGGTATTTTATCCAAGTGAAGATGCTGT
Camel      TCTGCATAATGGGAGGAAACTAACAAGTTCAGGGGTATCTTATCCAAGTGAAGATGCTGT
Pig        TCTGCCTAGTGGGAGGAAAATGAGGGGTTCTGGAGTATTGAGGCCAACCGAAGATGCTAT

                            140                 160                 180
Sheep      CAGGGAGGGTTCCGAATAAGGCAGTGAGGGGAACCCCGCACCAGCTGAGACCTGGGTGGG
Ox         TAGGGAGGGTTCCGAATAAGGCGGGGAGGGGAACCGCGCACCAGCTTAGACCTGGGTGGG
RedDeer    CAGGGAGGGTTCCGAATAAGGCAGTGAGGGGAACCGCGCACCAACTTAGACCTGAGTGGG
Giraffe    CAGGGAGGGTTTCAAATAAGGCAGTGAGGGGAACCGCGCACCAACTTAGACCTGGGTGGG
Chevrotain CAGCGAGGGTTCCAAATAAGGCAGTGAGGAGAG----GCACCGCCTTAGACCCGGGTGGG
Dolphin    CAAGGGGGGTTCCTAATAAAGCAGTGAGGAGAACCGCGCAGCAGCCTAGACCCGGGCGTG
Whale      CAAGGGGGGTTCCTAATAAAGCGGTGAGGAGAACCGCGCACCAGCCTAGACCCGGGCGCG
Hippo      CA-GGGGGTTTCAGAATAAAGCAGTGAGGAGAACCACGCTCCGGCTTAGACCTAGGCAAG
Camel      CAGGGGCTGTTCTGCATAAAGCAGTGAGGAGGACAGTGCACCAGCTCAGATCTGGTGCGG
Pig        CAAGGGGATTCCCAAGAAAAGCAGCAAGGAGAACCGCGCCCCAGTGTAGACCTGGAT-GG

                       195
Sheep      TGTGTCTCCCCCCAG
Ox         TGTGTCTTCCCCCAG
RedDeer    CGTGTCTTCCCCCAG
Giraffe    TGTGTCTTCCCCCAG
Chevrotain CGTGCCTTCTCCCAG
Dolphin    TGTTCCTTCTCCCAG
Whale      TGTTCCTTCTCCCAG
Hippo      TGTTCCTTCTCCCAG
Camel      GTGTTCTTCGTCCAG
Pig        CTGTCCCTCTCCCAG 
Intron 3
                             20                  40                  60
Sheep      GTGAGTGGCCACCTAGGACCGAGGAGCAGGGGACCTCCTCATCCTAAGTAGGCTGCCCCA
Ox         GTGAGTGGCAACCTCGGACCGAGGAGCAGGGGACCTCCTCATCCTAAGTAGGCTGCCCCA
RedDeer    GTGAGTGGCCACCTAGGACCGAGGAGCAGGGGACCTCCTCATCCTAAGGAGGCTGCCCCA
Giraffe    GTGAGTGGCCACCTAGGACCGAGGAGCAGGGGACCTCCTCATCCTAAGTAGGCTGCCCCA
Chevrotain GTGAGTGGCCATCGCGGACCGAGATGCAGGGGCCTCTCTCTTCCTGAGTAGGCTGCTCCA
Dolphin    GTGAGTGGCCACCGCGGACCGAGGAGCAGGGGCCTCCCTCATCCTAAGAAGGCTGCCCCT
Whale      GTGAGTGGCCACCGCGGACCGAGGGGCAGGGACCTCCCTCATCCTCAGAAGGCTGCCCCA
Hippo      GTGAGTGGCCACCGCGGACCGAGGAGCAGGGGCCTCCCTCATCCTAAGGAGGCTGCCCCA
Camel      GTGAGTGGTCATCCCCGGCCGAGGAGCAGGGACCTCGTTCTTCCTAAGAATGTTGCCCCA
Pig        GTGAGTGGCCACCGCCAGCCGGGGAGCAGGGGCCTCCCTCTTCCTAAGAAGGCTGCCCCA

                             80                 100                 120
Sheep      GCTCTCTGCACCGGGCCTGGGGCGTCCTTCTCCCCGAGGTGGCAGAGGGGATGGCAGTGG
Ox         GCTCTCCGCACCGGGCCTGGGGCGGCCTTCTCCCCGAGGTGGCGGAGGTGATGGCAGTGG
RedDeer    GCTCTCCGCACCAGGCCTGGGGTGGCCTTCTCCCCGAGGTGGCAGAGGGGATGACAGTGG
Giraffe    GCTTTCCACACCGGGCCTGGGGCGGCCTTCTCCCCGAGGTGGCAGAGGGGATGGCAGTGG
Chevrotain TCTCTCCGCACCAGCCCTTGGGTGGCCTTCTCCCCGAGCGGGCAGAGGGGATGGCATTTG
Dolphin    TCTCTCAGCATCGGGCCTTGGGCTGTCTTCTCTCCGAGGAGGTGCAGGGGCCGGTGGCGG
Whale      TCTCTCCGCAGCGGGCCTTGGGCTGTCTTCTCCCCGAGGAGGCGCAGGGGCTGGTGGCGG
Hippo      TCTGTCCTCATCTGGCCTTGGGCGGCCTTCTCCCCGAGGTGGCGGAGGGGTTGGCGGAGG
Camel      TCTCTTCACACTGGATCCTGGGTAGCCTTCTCTCCAAGGCGGCGGGTGAGATGGCGGCGG
Pig        TCTCTCATCACAGGGCCTTGGGCGGCCTTCTCCCCGAGCTGGTGGGGGTGATGGTGGCAG

                            140               158
Sheep      AGGATGGCAGCACCGACCAACCACCCATCTGCCAGCAG
Ox         AGGATGGCGGCACCCACCGACCACCCATCTGCCAGCAG
RedDeer    AGGGTGACGGCGCCCACCAACCACCCATCTGCCAGCAG
Giraffe    AGGATGGTGGCACCCACCGACCACCCATCTGCCAGCAG
Chevrotain AAAGTGACGGCCCCCACTGCCCACCCCTCTGTCCCCAG
Dolphin    AAGGTGCCACCGCCCACCACCCACCCATCTGCCCGCAG
Whale      AAGGTGGCGGCACCCACCACCCACCCATCTGCCCGCAG
Hippo      GTGGTGTCGGCGCCCAGCACCCACCCATCTGTCCGCAG
Camel      AGGGTGGCAGCACCCACCGCCCCCACTTCGGTCCACAG
Pig        AGGGCGGCAGCGCCCCCCATCCACGCATCTGCCCGCAG


Intron 4

                             20                  40                  60
Sheep      GTGAGGATGGCATTGTGGGTCCCCCATGCTGGGGCCATGCTCACCCTCTCCTGGCTTAGC
Ox         GTGGGGATGGCGTTGTGGGTCCCCCATGCTGGGGCCATGCCCGCCCTCTCCTGGCTTAGC
RedDeer    GTGGGGATGCCGTTGTGGGTCCCCCACCCTGGGGCCATGCCCACCCTATCCTGGCTTAGC
Giraffe    GTGGGGATGGCGTTGTGGGTCCCCCACGCTGGGGCCATGCCCGCCCTCTCCTGGCTTAGC
Chevrotain GTGGGGATGACGTTGTGGGTCCCCCACCCTGGGGCCATGCCCGCCCTCTCCTGACTTAGC
Dolphin    GTGGGGATGGCGTAGTGGGTCCCCCAGACTGGGACCACGCCCGCCCTCTCCTGGCTTAGC
Whale      GTGGGGATGGCGTAGTGGGGCTCCCAGCCTGGGCCCGCGGCCGCCCTCTCCTGGCTTAGC
Hippo      GTGGGGATGGCGTTGCGGGTCCTCCACCCTGGGCCCATGCCCGCCCCCTCCTGGCTTAGC
Camel      GTGGGGATGGCGTCGTGGGTCCCCTAT-CTGGCCCCAGGCCCGCCCTCTCCTGCCTTAGC
Pig        GTGGGGA-GGCGCGCTGGGTCCCGCACACTGGGCCCATGCCGGCTCTCTCCCGGCTGAGC

                             80                 100                 120
Sheep      CAGGAGAACACACGTGGGCTGGGGGAGAGAGATCCCTGCTCTCTTAGCAGCCCAGCCTTG
Ox         CAGGAGAATGCACGTGGGCTTGGGGAGACAGATCCCTGCTCTCTTAGCAGTCCAGCCTTG
RedDeer    CCAGAGAACACGCAAGGACGGGGGGAGAGAGATCCCTGCTCTCTTAGAAGTCCAGCCTTG
Giraffe    CCAGGGAACGCACGTGGGGTGGGGGAGAGAGAAACCTGCTCTCTTAGCAGTCCAGCCTTG
Chevrotain TGACCAGACGCA--------------------------------TAGCCGTCCAACCTTG
Dolphin    CGAGGGGGCTCCCGTGGGCTGGGGGAGAGAGGTGCCTGCTCTCTTGGCAGTTCAGCCTTG
Whale      CGAGGGGGCTTACGTGGGCTGGGGAAGAGAGGTGCCTGCTCTCTTGGCGGTCCAGCCTTG
Hippo      CGAGGGGGCGCACGTGAGCTGGGGGAGAGAGGTACTTGCTCTCTTAGCAGTTCGGCCTTG
Camel      CGAGGGGGCTCAGGTGGGCTGGGAAGAGAGGCGCCCTGCTCTGTTAGC-GTCCAGCCTAG
Pig        GGAGCGGACGCACGTGGGCTGGGGGAGAGGG-TCCCGATGCTCTTAGCAGTTCACTCTCG

                            140                 160                 180
Sheep      ACCCAGGAGAAACCTCTTCCCCTTTTGAAACCTCCTTCCTCGCCCTTCTCCAAGCCTATA
Ox         ACCCAGGGGAAACCTTTTCCCCTTTTGAAACCTCCTTCCTCGCCCTTCTCCAAGCCTGTA
RedDeer    ACTCAGGAGAAACCTTTTCCCCTTTTGAATCCTCCCTCCTCGCCCTTCTCCAAGCCTAGA
Giraffe    ACCCAGGAGAAACGTTTTCCCCTTTTAAGTCCTCCCTCCTCGCCCTTCTCCAAGCCTAGA
Chevrotain ACCCAGAAATCAGTGCCACGGCCCATTTGAAAT---------CCCTTCTCCAAGCCTGGA
Dolphin    ACCCAGGAGAAATCTTTTCCCCTTGTGAGTCCTCCCTCCACACCCTTCTCCAAGCCTGGA
Whale      ACCCGGGAGAAATCTTTTCCCCTTGTGAGTCCTCCCTCCACACCCTTCTCCAAGCCTGGA
Hippo      ACCCAGGAGAAATCTTTTCCCCTTTTGAGTCCTCCCTCCACGCCCTTGCCCAAGCCTGGA
Camel      ACCCAGGAGAAATCTTTTTCCCTTTTGAATGCTTCCTCCTTGCTCTTTTCCAAGCCTGGA
Pig        ACCCGGAGAAATCTTTTCCTCCTGCGGAGTCTTCCCTCTTTGTCCTTCTCCAAGCATGGA

                            200                 220                 240
Sheep      GGGGAGGGTGGAAAATGGAGCGGGCAGGAGGGAGCCGCTCCTCAGGGCCCCCTCTCTGTC
Ox         GGGGAGGGTGGAAAATGGAGCGGGCAGGAGGGAGCTGCTCCTGAGGGCCCCCTCTCTGTC
RedDeer    GGGGAGGGTGGAAAACAGAGCGGGCAGGAGGGAGCCGCTCCTGAGGGCCCCCTCTCTGTC
Giraffe    GGGGAGGGTGGAAAATGGAGCGGGCAGGAGGAAGCCGCTCTTGAGGGCTCCCTCTCTGTC
Chevrotain GGGGAGGGTGGAAGTGGAGGGAGTCAGGAGGGAGCAGTTCCCAAGGGCTCGC-CTCTCTC
Dolphin    GGGGAGGGTGGCAACTGGAGGGGACGGGAGGCAGCCGCTCCCAAGGGCTCCCTGTCTGTC
Whale      GGGGAGGGTGGCCAATGGAGGGGACGGGAGGCAGCCGCTCCCAAGGGCTCCCTGTCTGTC
Hippo      GGGGAGGGTGGAAAATGGAGGGGAAGGGATGGAGCCA---------GCTCCCTCTCTGTC
Camel      GGGGAGGGTGGGAAGTGGAGGGGAAGAGAAGGAGCGGCTCCCAAGGACTCCCTCTCTGTC
Pig        GGGGAGGGTGGAAGACGGAGGGGACAGGAGAGCGCCGCTGCCAAGGACTCGGCCTCTGTC

                         257
Sheep      TCTCCCTCCCTTGGCAG
Ox         TCTCCCTCCCTTGGCAG
RedDeer    TCTCCCTCCTTTGGCAG
Giraffe    TCTTCCTCCCTTGGCAG
Chevrotain TCTCCCTC----GGCAG
Dolphin    TCTCCCTCCCTTTGCAG
Whale      TCTCCCTCCCTTTGCAG
Hippo      TCTCCCTCCCTTTGCAG
Camel      TCTCCCTCTCTTTGCAG
Pig        TCTCTCTCCCTTTGCAG
Return to alignment of complete introns

Return to list of Alignments

Home


Last update 24 September 2004